View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17386_high_12 (Length: 334)

Name: NF17386_high_12
Description: NF17386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17386_high_12
NF17386_high_12
[»] chr3 (4 HSPs)
chr3 (87-211)||(32062504-32062628)
chr3 (236-313)||(32062680-32062757)
chr3 (242-313)||(32062551-32062622)
chr3 (100-206)||(32062652-32062758)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 87 - 211
Target Start/End: Original strand, 32062504 - 32062628
Alignment:
87 caacatgtttgggaagccaatagactctgttagaaagaaaaggtcattgaagcaagagaatgcactggagaacaatagtggaaaggaattcggtgggttt 186  Q
    |||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||    
32062504 caacatgtttgggaagccaatagactttgttagaaagaaaaggtcactgaagcaagagaatgcaccggagaacaatagtggaaaggaattcggtgggttt 32062603  T
187 tcaatccttgccgatgatgatgatg 211  Q
    |||||||||||||||||||||||||    
32062604 tcaatccttgccgatgatgatgatg 32062628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 236 - 313
Target Start/End: Original strand, 32062680 - 32062757
Alignment:
236 gattaatgaagcaggagaaagcaccggggaacaacagtggaaaggaactcagtgggttttcgatacttgcggatgatg 313  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32062680 gattaatgaagcaggagaaagcaccggggaacaacagtggaaaggaactcagtgggttttcgatacttgcggatgatg 32062757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 313
Target Start/End: Original strand, 32062551 - 32062622
Alignment:
242 tgaagcaggagaaagcaccggggaacaacagtggaaaggaactcagtgggttttcgatacttgcggatgatg 313  Q
    ||||||| ||||| ||||||| |||||| |||||||||||| || |||||||||| || ||||| |||||||    
32062551 tgaagcaagagaatgcaccggagaacaatagtggaaaggaattcggtgggttttcaatccttgccgatgatg 32062622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 100 - 206
Target Start/End: Original strand, 32062652 - 32062758
Alignment:
100 aagccaatagactctgttagaaagaaaaggtcattgaagcaagagaatgcactggagaacaatagtggaaaggaattcggtgggttttcaatccttgccg 199  Q
    ||||||||||| | |||| | || ||||| | | ||||||| ||||| |||| || |||||| |||||||||||| || |||||||||| || ||||| |    
32062652 aagccaatagattttgttcggaaaaaaagattaatgaagcaggagaaagcaccggggaacaacagtggaaaggaactcagtgggttttcgatacttgcgg 32062751  T
200 atgatga 206  Q
    |||||||    
32062752 atgatga 32062758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University