View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17387_high_11 (Length: 357)
Name: NF17387_high_11
Description: NF17387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17387_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 60 - 336
Target Start/End: Original strand, 6026937 - 6027214
Alignment:
| Q |
60 |
ccttcagcataaccggaaccagcatcatcgtgttatgccggttccggagttgcttgaaggtgatggttctggtgattttgctgagagagttgatttgaat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026937 |
ccttcagcataaccggaaccagcatcatcgtgttatgccggttccggagttgcttgaaggtgatggttctggtgattttgctgagagagttgatttgaat |
6027036 |
T |
 |
| Q |
160 |
aagattcctgaaccagagagttctgatgagtgggatgttaattgatattggaaggaaaaaagtttgaagaatcgatt-aaaaaagtgattcttcttcttt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6027037 |
aagattcctgaaccagagagttctgatgagtgggatgttaattgatattggaaggaaaaaagtttgaagaatcgattaaaaaaagtgattcttcttcttt |
6027136 |
T |
 |
| Q |
259 |
tttcgcgtttgggctatggttgctaacgtgcgctgtggaagttctttaacggctgaagcaaaaatcttgttgatgatg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027137 |
tttcgcgtttgggctatggttgctaacgtgcgccgtggaagttctttaacggctgaagcaaaaatcttgttgatgatg |
6027214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University