View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17387_high_6 (Length: 390)
Name: NF17387_high_6
Description: NF17387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17387_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 84 - 367
Target Start/End: Original strand, 48763700 - 48763983
Alignment:
| Q |
84 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763700 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
48763799 |
T |
 |
| Q |
184 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctctctaaattgcatctctaca |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763800 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctctctaaattgcatctctaca |
48763899 |
T |
 |
| Q |
284 |
acttgactagggttttggttgggattttttaggtggagtattatttcagtgatttaaacttggctaccaccgatcatttgatga |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48763900 |
acttgactagggttttggttgggattttttaggtggagtattatttcagcgatttaaacttggctaccaccgatcatttgatga |
48763983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University