View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17387_high_9 (Length: 366)
Name: NF17387_high_9
Description: NF17387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17387_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 42092107 - 42092453
Alignment:
| Q |
1 |
tattcattctctttcccattatgctgaacagtttcgaatcctgttcttagtttcattgctgaatttgttgttattgtttgtcaatagaaaaatggagcta |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092107 |
tattcattctctttcccattatgctcaacagtttcgaatcctgttcttagtttcattgctgaatttgttgttattgtttgtcaatagaaaaatggagcta |
42092206 |
T |
 |
| Q |
101 |
atgctgagatagttgacataaacaagactacaacgacgttggaaccggaaaagtctacaggtggtggactctatgttcccgggaaggatcgtgtggttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42092207 |
atgctgagatagttgacataaacaagactacaacgacgttggaaccggaaaagtctacaggtggtggactctatgttcctgggaaggatcgtgtggttta |
42092306 |
T |
 |
| Q |
201 |
cgtggcaccggagagaaaatcacgtttgggtattgctttgttttgtagttcattttaaatttttatatgatgattcaatgacaccagagaccagctaggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42092307 |
cgtggcaccggagagaaaatcacgtttgggtattgctttgttttgtagttcattttaaatttttatatgatgattcaatgacaccagagaccagctaggt |
42092406 |
T |
 |
| Q |
301 |
tgtaaaaaaccgacacaatttatttagcttagcagagatgatgatgt |
347 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42092407 |
tgtaaaaaaccgacacgatttatttagcttagcagagatgatgatgt |
42092453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University