View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17389_high_15 (Length: 250)
Name: NF17389_high_15
Description: NF17389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17389_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 48942514 - 48942358
Alignment:
| Q |
1 |
tatcgtttccttatcgtaatctcaattgggtgggtttttgcttcaatacaaagccaaaacaatcccataatgagacgttggggcttatcttttcggattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48942514 |
tatcgtttccttatcgtaatctcaattgggtgggtttttgcttcaatacaaagccaaaacaatcccataatgagacgttggggcttatctttttggattt |
48942415 |
T |
|
| Q |
101 |
ttcctctagcttaagttctgttttgatcttgtgtaacttctgttctatggctgtata |
157 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48942414 |
ttcctctggcttaagttctgttttgatcttgtgtaacttctgttctatggctgtata |
48942358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 38984669 - 38984727
Alignment:
| Q |
104 |
ctctagcttaagttctgttttgatcttgtgtaacttctgttctatggctgtataggggt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
38984669 |
ctctagcttaagttctgttttgatcttgtgtaacttctgttctacggctgtataagggt |
38984727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University