View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17389_low_22 (Length: 225)
Name: NF17389_low_22
Description: NF17389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17389_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 79 - 207
Target Start/End: Original strand, 41497222 - 41497350
Alignment:
| Q |
79 |
aaagaaaaccaactaatataatctatgtaaccttttataatgtgaattatatcaggtgaattgggatctcgtgaagagaaatatggtgcctctcctcata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497222 |
aaagaaaaccaactaatataatctatgtaaccttttataatgtgaattatatcaggtgaattgggatctcgtgaagagaaatatggtgcctctcctcata |
41497321 |
T |
|
| Q |
179 |
cagattatggcatgatcactctcctattg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41497322 |
cagattatggcatgatcactctcctattg |
41497350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 123 - 206
Target Start/End: Original strand, 41491033 - 41491116
Alignment:
| Q |
123 |
aattatatcaggtgaattgggatctcgtgaagagaaatatggtgcctctcctcatacagattatggcatgatcactctcctatt |
206 |
Q |
| |
|
||||| || ||||||||||||| || |||||||| || |||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41491033 |
aattacattaggtgaattgggacctaatgaagagatatgtggtgcctctgctcattcagattatggcatgatcactctcctatt |
41491116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 57
Target Start/End: Original strand, 41497154 - 41497198
Alignment:
| Q |
13 |
attattctaaagttttttctgccgtactttattagtagagtcaag |
57 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41497154 |
attaatctaaagttttttctgccgtactttattagtagagtcaag |
41497198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 162 - 204
Target Start/End: Original strand, 41483226 - 41483268
Alignment:
| Q |
162 |
tggtgcctctcctcatacagattatggcatgatcactctccta |
204 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
41483226 |
tggtgcctctgctcattcagattatggcatgatcactctccta |
41483268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University