View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17390_high_3 (Length: 267)
Name: NF17390_high_3
Description: NF17390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17390_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 249
Target Start/End: Complemental strand, 42694817 - 42694580
Alignment:
| Q |
12 |
agagattggcagaaatctttatgaaataacaaaaggttgtcccttgcatgctttttgtaggatgaaagctcttgtaatttgcacaccttaaaagagaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694817 |
agagattggcagaaatctttatgaaataacaaaaggttgtcccttgcatgctttttgtaggatgaaagctcttgtaatttgcacaccttaaaagagaaaa |
42694718 |
T |
|
| Q |
112 |
cgtaggccttcttgattgaaatgtgtcccctattcccatattccaaaaatgaacatcaacctatttgggcatacaatgtttcatagttcacacacaataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694717 |
cgtaggccttcttgattgaaatgtgtcccctattcccatattccaaaaatgaacatgaacctatttgggcatacaatgtttcatagttcacacacaataa |
42694618 |
T |
|
| Q |
212 |
gacacactcttggtagctgctatatgagactagactta |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694617 |
gacacactcttggtagctgctatatgagactagactta |
42694580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University