View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17391_high_5 (Length: 205)
Name: NF17391_high_5
Description: NF17391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17391_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 8447344 - 8447539
Alignment:
| Q |
19 |
aacaacaaggtagaagaagtgaagtgtatgaatta---------ttattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447344 |
aacaacaaggtagaagaagtgaagtgtatgaattattattattattattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatg |
8447443 |
T |
 |
| Q |
110 |
ttgagagagatgagttggaattggatttctttctcattgagacatgccaacactcttgagacggcggttgacaaggctggtccgtacactttcact |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447444 |
ttgagagagatgagttggaattggatttctttctcattgagacatgccaacactcttgagacggcggttgacaaggctggtccgtacactttcact |
8447539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University