View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17392_high_5 (Length: 265)
Name: NF17392_high_5
Description: NF17392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17392_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 35254536 - 35254363
Alignment:
| Q |
16 |
aaccacgcagcttctgctcctgctactataattgaagctacgaaaacacacacacaaaaccatgtgaataccactgttcttcctcttattgttcctgctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254536 |
aaccacgcagcttctgctcctgctactataattgaagctacgaaaacacacacacaaaaccatgtgaataccactgttcttcctcttattgttcctgctt |
35254437 |
T |
 |
| Q |
116 |
tggaattggaataattctgcaacgatatcttcatttttgtgaattgaattgaagcttagaaaagttagtgatga |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254436 |
tggaattggaataattctgcaacgatatcttcatttttgtgaattgaattgaagcttagaaaagttagtgatga |
35254363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 218 - 265
Target Start/End: Complemental strand, 35254334 - 35254287
Alignment:
| Q |
218 |
gtactgaattgcttcaatttacatttccaactaacctctcaactctct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35254334 |
gtactgaattgcttcaatttacatttccaactaacctctcaactctct |
35254287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University