View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17392_low_10 (Length: 209)
Name: NF17392_low_10
Description: NF17392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17392_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 21 - 169
Target Start/End: Original strand, 32450351 - 32450498
Alignment:
| Q |
21 |
ctaggtggactgatgagccatgaaaaattccaaaaaatatttcttcttttttgggtaattatatgattatattaaggactagggannnnnnngtctttct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32450351 |
ctaggtggactgatgagccatgaaaaattccaaaaaatatttcttcttttttgggtaattatatgattatattaaggactagggatttttttgtctttct |
32450450 |
T |
 |
| Q |
121 |
tttgatctccctttccttggttagaatataatctttcatttttaatgtg |
169 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32450451 |
tttgatc-ccctttccttggttagaatataatctttcatttttaatgtg |
32450498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University