View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17392_low_6 (Length: 253)
Name: NF17392_low_6
Description: NF17392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17392_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 54607716 - 54607482
Alignment:
| Q |
1 |
tgtgggtccaatattagttatataacaggagaagagagggnnnnnnnn---cattggctttttctgctagggcttaatagcagcaacaaattaaccgaaa |
97 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
54607716 |
tgtgggcccaatattagttatataacaggagaagagagagggaaaaaaaaacattggctttttctgctagggcttaacagcagcagcaaattaaccgaaa |
54607617 |
T |
|
| Q |
98 |
cccttcttcgattgagatgggagnnnnnnncagtatctagtctattgagtgcggcagtgtagggttttcggttcagattgagaggaaggaagaagatggc |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54607616 |
cccttcttcgattgagatgggagaaaaaaacagtatctagtctattgagtgcggcagtgtagggttttcggttcagattgagaggaaggaagaagatggc |
54607517 |
T |
|
| Q |
198 |
aaaaacaagtgttaatcgatatatggatatggact |
232 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| |
|
|
| T |
54607516 |
aaaaacaagtgttaaccaatatatggatatggact |
54607482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University