View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17394_high_25 (Length: 201)
Name: NF17394_high_25
Description: NF17394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17394_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 25 - 96
Target Start/End: Original strand, 12770677 - 12770748
Alignment:
| Q |
25 |
ctaatacttaggagaaaaattatccgaagagggtttatatattttaatttagggaaggtaggtatgaaccag |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12770677 |
ctaatacttaggagaaaaattatccgaagagggtttatatattttaatttagggaaggtgggtatgaaccag |
12770748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 183
Target Start/End: Original strand, 12770805 - 12770833
Alignment:
| Q |
155 |
agaaagagccaaacacatggcaccgaatt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12770805 |
agaaagagccaaacacatggcaccgaatt |
12770833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University