View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17394_low_16 (Length: 272)
Name: NF17394_low_16
Description: NF17394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17394_low_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 24 - 272
Target Start/End: Complemental strand, 30138523 - 30138275
Alignment:
| Q |
24 |
accttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccacaggcattggagttttcttct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138523 |
accttagccattccaatcctcactttcatctctttccaccttaacagccaataccaaaccctaatcacagcagcatccacaggcattggagttttcttct |
30138424 |
T |
 |
| Q |
124 |
gtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaagttcatctcacactcacca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138423 |
gtcttccagcaggattcttcaaaacaaccttaatcttcattccctacattgctttcatagtcttagctagcacagttgcaagttcatctcacactcacca |
30138324 |
T |
 |
| Q |
224 |
tcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30138323 |
tcttgctctcatgatttcttccttcaacaaatccaaaacaaacaaagtt |
30138275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University