View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17394_low_18 (Length: 268)
Name: NF17394_low_18
Description: NF17394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17394_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 55 - 154
Target Start/End: Original strand, 16323960 - 16324059
Alignment:
| Q |
55 |
ttttataagcacttaaatattttactaggggatataaccttgcacttatcccttnnnnnnngaaaccttgtacttcggatggttctccacttttcggtta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16323960 |
ttttataagcacttaaatattttactaggggatataaccttgcacttatcccttaaaaaaagaaaccttgtacttctgatggttctccacttttcggtta |
16324059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University