View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17394_low_25 (Length: 209)

Name: NF17394_low_25
Description: NF17394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17394_low_25
NF17394_low_25
[»] chr5 (6 HSPs)
chr5 (32-135)||(39311027-39311130)
chr5 (144-193)||(39311391-39311440)
chr5 (14-91)||(38849201-38849275)
chr5 (146-191)||(39315870-39315915)
chr5 (1-66)||(38868225-38868290)
chr5 (146-193)||(38137221-38137268)


Alignment Details
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 32 - 135
Target Start/End: Original strand, 39311027 - 39311130
Alignment:
Q  32 ttcagcttcaccccagaaattaacctggcctcaaactagtttatgtgtggacaagtct--ttagtagctttgctggcttatgattctcatactatatttt 129  Q
    |||||||||||| ||||||||||||| |||||||||||||||  ||||||||||||||  ||||| ||||||||||||||||||||||||||||||||||    
T  39311027 ttcagcttcaccacagaaattaaccttgcctcaaactagttt--gtgtggacaagtctctttagtggctttgctggcttatgattctcatactatatttt 39311124  T
Q  130 atcctt 135  Q
    ||||||    
T  39311125 atcctt 39311130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 144 - 193
Target Start/End: Original strand, 39311391 - 39311440
Alignment:
Q  144 gacaagtgcagtgcaaactgtgtgtggacaagcttatggagccaaaaaac 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39311391 gacaagtgcagtgcaaactgtgtgtggacaagcttatggagccaaaaaac 39311440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 14 - 91
Target Start/End: Original strand, 38849201 - 38849275
Alignment:
Q  14 cttaattatgtcaaatgattcagcttcaccccagaaattaacctggcctcaaactagtttatgtgtggacaagtcttt 91  Q
    |||||||||||||||||||||||||| ||   ||||||||||||||||| |||||||||||||||| ||| |||||||    
T  38849201 cttaattatgtcaaatgattcagctttac---agaaattaacctggccttaaactagtttatgtgtagaccagtcttt 38849275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 146 - 191
Target Start/End: Original strand, 39315870 - 39315915
Alignment:
Q  146 caagtgcagtgcaaactgtgtgtggacaagcttatggagccaaaaa 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  39315870 caagtgcagtgcaaactgtgtgtggacaagcttatggagccaaaaa 39315915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 38868225 - 38868290
Alignment:
Q  1 atacttgctggctcttaattatgtcaaatgattcagcttcaccccagaaattaacctggcctcaaa 66  Q
    |||||||| |||||||||| ||| |||||||||||||| |||| ||||||||||||||| ||||||    
T  38868225 atacttgccggctcttaatcatgccaaatgattcagctgcaccacagaaattaacctggtctcaaa 38868290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 146 - 193
Target Start/End: Complemental strand, 38137268 - 38137221
Alignment:
Q  146 caagtgcagtgcaaactgtgtgtggacaagcttatggagccaaaaaac 193  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||    
T  38137268 caagtgcagtgcaaaatgtatgtggacaagcttatggagccaaaaaac 38137221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University