View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17395_high_1 (Length: 474)
Name: NF17395_high_1
Description: NF17395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17395_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 50
Target Start/End: Complemental strand, 30168446 - 30168411
Alignment:
| Q |
15 |
gagaagaaaaagacacgtaggacttccaaaattggg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30168446 |
gagaagaaaaagacacgtaggacttccaaaattggg |
30168411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 79 - 123
Target Start/End: Complemental strand, 43245428 - 43245384
Alignment:
| Q |
79 |
tgcatttcttgcttgtttcatttgtaaatttcagcatttcccttt |
123 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
43245428 |
tgcatttcttgcttgttacattcgtaaatttcagcattttccttt |
43245384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University