View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17395_high_8 (Length: 323)
Name: NF17395_high_8
Description: NF17395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17395_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 56 - 316
Target Start/End: Complemental strand, 29519789 - 29519534
Alignment:
| Q |
56 |
cacatcaaggaaaaaataatttataataacttagagctttcaatcaagagagatttatttgattgttctcttcagaatcaaaatggtgggtattttctcg |
155 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519789 |
cacatcaaggaaaaaataat----aatagcttagagctttcaatcaagagagatttatttgattattctcttcagaatcaaaatggtgggtattttctcg |
29519694 |
T |
 |
| Q |
156 |
ttggttacgggcatggctggaccaagtggatttggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519693 |
ttggttacgggcatggctggaccaagtggatttggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatca |
29519594 |
T |
 |
| Q |
256 |
cagg---nnnnnnnaattcaccttgtttgtttgaacatgaaaatgatgtgatatatttcatttc |
316 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519593 |
caggttttttttttaattcacc----ttgtttgaacatgaaaatgatgtgatatatttcatttc |
29519534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 29519854 - 29519812
Alignment:
| Q |
1 |
atctcaatcatattatattcatcccacacgttatcttcatttg |
43 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29519854 |
atctcaatcatattttattcatcccacacgttatcttcatttg |
29519812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 168 - 259
Target Start/End: Original strand, 40098961 - 40099052
Alignment:
| Q |
168 |
atggctggaccaagtggatttggatcctctacaacagctgaacaagttactcaaggaattgatgcaagcaacctcactgcaattatcacagg |
259 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||| || || || |||||||||||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
40098961 |
atggctggtccaagtgggtttggatcagcttcaactgcagagcaggttactcaaggaattgatgctagcaaccttaccgcaattatcacagg |
40099052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University