View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17395_low_10 (Length: 317)
Name: NF17395_low_10
Description: NF17395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17395_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 5e-56; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 85 - 219
Target Start/End: Complemental strand, 41619253 - 41619119
Alignment:
| Q |
85 |
cttactatttttataaaagaaataatatttgtacaacgtgtgacaacttttgaacaaccatatcttgtattcggattgtgttcatatcctatctcttttt |
184 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41619253 |
cttactatttttataaaagaaatgatatttgtacaacgtgtgacaacttttgaacaaccatctcttatatttggattgtgttcatatcctatctcttttt |
41619154 |
T |
 |
| Q |
185 |
tcccctctctatcactattatttttgactaataag |
219 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
41619153 |
ttccctctctatcactattatttttaactaataag |
41619119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 92 - 185
Target Start/End: Original strand, 41617056 - 41617149
Alignment:
| Q |
92 |
tttttataaaagaaataatatttgtacaacgtgtgacaacttttgaacaaccatatcttgtattcggattgtgttcatatcctatctctttttt |
185 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||| ||| |||||||||||||| | |||| ||||| |||||||| |||||||||| |||||| |
|
|
| T |
41617056 |
ttttcataaaagaaatgatatttttacaacgtttgataacttttgaacaactctctcttatattcacattgtgtttctatcctatctatttttt |
41617149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 302
Target Start/End: Complemental strand, 41619052 - 41619020
Alignment:
| Q |
270 |
cctaatttattgtccctttgaaatttaaaatct |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41619052 |
cctaatttattgtccctttgaaatttaaaatct |
41619020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 90 - 121
Target Start/End: Original strand, 35044634 - 35044665
Alignment:
| Q |
90 |
tatttttataaaagaaataatatttgtacaac |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35044634 |
tatttttataaaagaaataatatttgtacaac |
35044665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University