View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17395_low_13 (Length: 227)
Name: NF17395_low_13
Description: NF17395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17395_low_13 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 92 - 227
Target Start/End: Original strand, 11135534 - 11135668
Alignment:
| Q |
92 |
aagtcatggccattatttaaaatataattgtctagtctttataaataacggtttgattaatgcccaatcatactcataacaacaaaatgaactcctttgg |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11135534 |
aagtcatggccattatt-aaaatataattgtctagtctttataaataacggtttgattaatgtccaatcatactcataacaacaaaatgaactcctttgg |
11135632 |
T |
 |
| Q |
192 |
tctcacgttgactgctctatgctgtgtagtggttgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11135633 |
tctcacgttgactgctctatgctgtgtagtggttgt |
11135668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 35 - 109
Target Start/End: Original strand, 11135440 - 11135514
Alignment:
| Q |
35 |
ccaaaagaaaatgtttgttgctatatattattacaatttgcaacctcaatactttacaagtcatggccattattt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11135440 |
ccaaaagaaaatgtttgttgctatatattattacaatttgcaacctcaatactttacaagtcatggccattattt |
11135514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University