View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17395_low_15 (Length: 205)
Name: NF17395_low_15
Description: NF17395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17395_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 29519832 - 29519999
Alignment:
| Q |
17 |
gatgaatataatatgattgagataagaagaaagaagaattaatgaggaaggtatagtatgaggctaggaaggaaattaggattagtttgggaagagggaa |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519832 |
gatgaataaaatatgattgagataagaagaaagaagaattaatgaggaaggtatagtatgaggctaggaaggaaattaggattagtttgggaagagggaa |
29519931 |
T |
|
| Q |
117 |
gaaaagcatgaataaatagtttgggaaatagcaggtactccatcacctttatatttgggacataacat |
184 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519932 |
gaaaagcatgaatgaatagtttgggaaatagcaggtactccatcacctttatatttgggacataacat |
29519999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University