View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17396_low_4 (Length: 221)

Name: NF17396_low_4
Description: NF17396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17396_low_4
NF17396_low_4
[»] chr5 (2 HSPs)
chr5 (50-147)||(6247473-6247570)
chr5 (148-197)||(6247732-6247781)
[»] chr2 (2 HSPs)
chr2 (50-122)||(1627139-1627211)
chr2 (121-197)||(1627838-1627909)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 50 - 147
Target Start/End: Original strand, 6247473 - 6247570
Alignment:
50 aagagctttcttctaaagatgtggcaatcatgaagaggcgcattgccaatgttcttgaaccagaggaaacagtcttgcaaggcttgagaaggttaaaa 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||    
6247473 aagagctttcttctaaagatgtggcaatcatgaagaggcgcattgccaatgttcttgaaccagaggaaacagtcttgcaaggtttgagaagattaaaa 6247570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 6247732 - 6247781
Alignment:
148 taaaaggcaacggtgatagaaaaacaaagatgtctggtgagactaagatt 197  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||    
6247732 taaaaggcaacggtgatagaaaaacaaaaatgtctggtgagactaagatt 6247781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 50 - 122
Target Start/End: Original strand, 1627139 - 1627211
Alignment:
50 aagagctttcttctaaagatgtggcaatcatgaagaggcgcattgccaatgttcttgaaccagaggaaacagt 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
1627139 aagagctttcttctaaagatgtggcaatcatgaagaggcgcattgcaaatgttcttgaaccagaggaaacagt 1627211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 121 - 197
Target Start/End: Original strand, 1627838 - 1627909
Alignment:
121 gtcttgcaaggcttgagaaggttaaaataaaaggcaacggtgatagaaaaacaaagatgtctggtgagactaagatt 197  Q
    ||||| |||||||||||||||||||||     |||| |||||||||||| ||||| |||||||||||||||||||||    
1627838 gtcttacaaggcttgagaaggttaaaa-----ggcagcggtgatagaaagacaaaaatgtctggtgagactaagatt 1627909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University