View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17397_high_8 (Length: 202)
Name: NF17397_high_8
Description: NF17397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17397_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 2e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 5269769 - 5269943
Alignment:
| Q |
14 |
gagaagaattggaacaagttttgctgaagttgattaacaaaatagtgatggaggaacatgttcagttcattgcatctgactgcaagatagctacaaactc |
113 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5269769 |
gagaagaattggaacaagttttgatgaatttgattaacaaaattatgatggaggaacatgttcaattcattgcatctgactgcaagctagctacaaactc |
5269868 |
T |
|
| Q |
114 |
tatttgttcccgttcaccagtcattgcctaaa-ttgggccttaaattcttagtttttgtgttagatgtttctttt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5269869 |
tatttgttcccgttcaccagtcattgcctaaagttgggccttaaattcttagtttttgtgttagatgtttctttt |
5269943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 5275893 - 5275808
Alignment:
| Q |
14 |
gagaagaattggaacaagttttgctgaagttgattaacaaaatagtgatggaggaacatgttcagttcattgcatctgactgcaag |
99 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||| || ||| |||| || |||||| |
|
|
| T |
5275893 |
gagaagaattggaacaagttttgatgaatttgattaacaaaattatgatggaggaacatgttcaatttatttcatcagattgcaag |
5275808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University