View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17397_high_9 (Length: 202)
Name: NF17397_high_9
Description: NF17397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17397_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 27643263 - 27643093
Alignment:
| Q |
16 |
ttcataagaccaaattggaggaaattgcttcctttgaagcaacggtgccagttctgcggtttcagtttcaacatgtatctagtatgaacaagagtaagga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27643263 |
ttcataagaccaaattggaggaaattgcttcctttgaagcaacggtgccagttctgcggtttcagtttcaacatgtatctagtatgaacaaaagtaagga |
27643164 |
T |
|
| Q |
116 |
ttatgggttctttgagtatgcagatacgtttaagagtatcagattctgggtggctaagttgagggagatga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27643163 |
ttatgggttctttgagtatgcagatacgtttaagagtatcagattctgggtggctaagttgagggagatga |
27643093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 50247628 - 50247798
Alignment:
| Q |
16 |
ttcataagaccaaattggaggaaattgcttcctttgaagcaacggtgccagttctgcggtttcagtttcaacatgtatctagtatgaacaagagtaagga |
115 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||| | |||||||||| | |||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
50247628 |
ttcataagaccaagttgaaggaaattgcttgctttgaagccatggtgccagttgtacggtttgagtttcaacatgtatctagtatgaacaagagtaaaga |
50247727 |
T |
|
| Q |
116 |
ttatgggttctttgagtatgcagatacgtttaagagtatcagattctgggtggctaagttgagggagatga |
186 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||| | |||||||||||||| |||||||||||| |
|
|
| T |
50247728 |
ttatgggtttttagagtatgctgatacgtttaagagtatcaaactctgggtggctaagctgagggagatga |
50247798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 50254765 - 50254935
Alignment:
| Q |
16 |
ttcataagaccaaattggaggaaattgcttcctttgaagcaacggtgccagttctgcggtttcagtttcaacatgtatctagtatgaacaagagtaagga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| || |||||||||| | || ||| ||||||||| ||||||||||||||| |||||||| | |
|
|
| T |
50254765 |
ttcataagaccaaattggaggaaattgcttgttttgatgccttggtgccagtttttcgatttgagtttcaacttgtatctagtatgaataagagtaaaaa |
50254864 |
T |
|
| Q |
116 |
ttatgggttctttgagtatgcagatacgtttaagagtatcagattctgggtggctaagttgagggagatga |
186 |
Q |
| |
|
||||| ||| ||||||||||| || |||||||| ||| | | |||||||||| ||| |||||||||||| |
|
|
| T |
50254865 |
ttatgagttttttgagtatgctgagacgtttaatagtgtgaaattctgggtgatgaagctgagggagatga |
50254935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University