View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17397_low_4 (Length: 274)
Name: NF17397_low_4
Description: NF17397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17397_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 34 - 245
Target Start/End: Original strand, 11476660 - 11476872
Alignment:
| Q |
34 |
ttaggagtttata-ccacaccatgccctacattgcatccgtccatggtctcttgtaatctggtctaacagcacccttatattaaaaaacaaagaaacttg |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11476660 |
ttaggagtttataaccacaccatgccctagattgcatccgtccatggtctcttgtaatctggtctaacagcacccttatattaaaaaacaaagaaacttg |
11476759 |
T |
 |
| Q |
133 |
aaaggtaccttaatgcacatctatctgtttttctatattgtatattttcttaacaaaaaactcatattattaatttttgagattgttacgatgtaaaata |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11476760 |
aaaggtaccttaatgcacatctatctgttttcctacattgtatattttcttaacaaaaaactcatattattaatttttgagattgttacgatgtaaaata |
11476859 |
T |
 |
| Q |
233 |
tggattgttgctt |
245 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
11476860 |
tagattgttgctt |
11476872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University