View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17397_low_5 (Length: 271)
Name: NF17397_low_5
Description: NF17397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17397_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 168
Target Start/End: Original strand, 35846281 - 35846448
Alignment:
| Q |
1 |
aggtagatttttacaactgtcaattagggaggaaggagggtaggaggagttgtcacatgatttgcaacagtacaaaaaaggggacagtaacatatctgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846281 |
aggtagatttttacaactgtcaattagggaggaaggagggtaggaggagttgtcacatgatttgcaacagtacaaaaaaggggacagtaacatatctgta |
35846380 |
T |
|
| Q |
101 |
tccattatgtaggtttattacaatttaaacacaactactagtatagcctgtccgaatattattcattc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846381 |
tccattatgtaggtttattacaatttaaacacaactactagtatagcctgtccgaatattattcattc |
35846448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 197 - 251
Target Start/End: Original strand, 35846486 - 35846540
Alignment:
| Q |
197 |
aaccttaaaagtctccctattataatatcttattaaacttttgatgactctaatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35846486 |
aaccttaaaagtctccctattataatatcttattaaacttttgatgactctaatt |
35846540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 124
Target Start/End: Complemental strand, 4928750 - 4928720
Alignment:
| Q |
94 |
atctgtatccattatgtaggtttattacaat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4928750 |
atctgtatccattatgtaggtttattacaat |
4928720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University