View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17398_low_11 (Length: 259)
Name: NF17398_low_11
Description: NF17398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17398_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 78 - 241
Target Start/End: Complemental strand, 46117763 - 46117600
Alignment:
| Q |
78 |
caaagtcccaaccgatgaaaatctaagattgagagggtgtagtttcccttctatgtgtaacttgtgcttcaagtaagaagagacttcatttcacattttc |
177 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46117763 |
caaagtcccaacagatgaaaatctaagattgagagggtgtagtttcccttctatgtgtaacttgtgcttcaagtaagaagagacttcatttcacattttc |
46117664 |
T |
|
| Q |
178 |
ttcaactgtacctattctctaaggatttggtcatggatagcagcctctctcaatctttctttct |
241 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46117663 |
ttcaactgtacctattctctcaggatttggtcatggatagcagcctctctcaatctttctttct |
46117600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 46117806 - 46117758
Alignment:
| Q |
1 |
cttcattgggcaaagactatttggagtgcagatgttcctccttcaaagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46117806 |
cttcattgggcaaagactatttggagtgcagatgttcctcgttcaaagt |
46117758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 36750327 - 36750275
Alignment:
| Q |
23 |
ggagtgcagatgttcctccttcaaagtttttgtttgtttggagaatgatgcat |
75 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||||| |||||||| |
|
|
| T |
36750327 |
ggagtgcagatgttcctctttcaaagtctttatttgtttggagattgatgcat |
36750275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University