View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17398_low_9 (Length: 282)

Name: NF17398_low_9
Description: NF17398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17398_low_9
NF17398_low_9
[»] chr5 (1 HSPs)
chr5 (36-87)||(12163621-12163672)


Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 87
Target Start/End: Complemental strand, 12163672 - 12163621
Alignment:
36 acagaccaaagtttttcaaaatatataattatttgattttagtattttatat 87  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||    
12163672 acagaccaaagtttttcaaaatatataataatttgattttagtattttatat 12163621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University