View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_105 (Length: 221)
Name: NF1739_high_105
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_105 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 29051043 - 29050916
Alignment:
| Q |
1 |
taaaaaagcgaggaatttgatgtttaaattaaatcctacacatgcataataatgttcatataactacaaatcaagttgtacttgcatgacgtttttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29051043 |
taaaaaagcgaggaatttgatgtttaaattaaatcctacacatgcataataatgttcatataactataaatcaagttgtacttgcatgacgtttttcttt |
29050944 |
T |
 |
| Q |
101 |
ttaaatctcaaaaatcaaatatatgtag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29050943 |
ttaaatctcaaaaatcaaatatatgtag |
29050916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 29050890 - 29050833
Alignment:
| Q |
150 |
atgttattggtttcacttggtgtcctttcggtggttgttcactttcactataagtgct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29050890 |
atgttattggtttcacttggtgtcctttctgtggttgttcactttcactataagtgct |
29050833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University