View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_110 (Length: 206)
Name: NF1739_high_110
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_110 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 32958762 - 32958948
Alignment:
| Q |
1 |
caaactagcagtcagaacagcctgaaactaacactctaaaaccatgacaggaaaccaaacatgttgctcgacagaaattgtgacgcatctcccccaaaat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32958762 |
caaactagcagtcacaacagcctgaaactaacactctaaaaccatgacaggaaaccaaacatgttgctcgacagaaattgtgacgcatctcccccaaaat |
32958861 |
T |
 |
| Q |
101 |
acgttgttgctgccttgtcacattccataaaacacaacaaatttgttaattaactatgtcatattttgtcagctactttatatttca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32958862 |
acgttgttgctgccttgtcacattccataaaacacaacaaatttgttaattaactatgtcacattttgtcagctactttatatttca |
32958948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 53 - 158
Target Start/End: Complemental strand, 49729865 - 49729760
Alignment:
| Q |
53 |
aaccaaacatgttgctcgacagaaattgtgacgcatctcccccaaaatacgttgttgctgccttgtcacattccataaaacacaacaaatttgttaatta |
152 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||| || |||| |||||||| ||||| ||| |||||||||||||||| ||| |
|
|
| T |
49729865 |
aaccaaacatgttgctcgatggaaattgtgacgcatctcccccaaaacacgccgtcgctgtcttgtcacgttccacaaagcacaacaaatttgttattta |
49729766 |
T |
 |
| Q |
153 |
actatg |
158 |
Q |
| |
|
| |||| |
|
|
| T |
49729765 |
attatg |
49729760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University