View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_112 (Length: 205)
Name: NF1739_high_112
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_112 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 41917988 - 41917799
Alignment:
| Q |
1 |
ttgttttcatgagtgttggcggtctttctaacataacttttcctctgcttcggagttgaaggttttggagtgccgttgcttccgggatggaatttcttta |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41917988 |
ttgttgtcatgagtgttggcggtctttctaacataacttttcctctgcttcggagttgatggttttggagtgccgttgcttccgggatggaatttcttta |
41917889 |
T |
 |
| Q |
101 |
atttctctggatacggagacaccactttaggttgatatttcttccttttaggtgttttttgcggctgatcattaacatcattttggctat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41917888 |
atttctctggatacggagacaccactttaggttgatatttcttccttttggctgttttttgcggctgatcattaacatcattttggctat |
41917799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 41918045 - 41917989
Alignment:
| Q |
16 |
ttggcggtctttctaacataacttttcctctgcttcggagttgaaggttttggagtg |
72 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41918045 |
ttggcagtctttctaacataacttttcctctgtttcggagttgaaggttttggagtg |
41917989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 1686914 - 1686865
Alignment:
| Q |
23 |
tctttctaacataacttttcctctgcttcggagttgaaggttttggagtg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
1686914 |
tctttctaacataacttttcctctgcttcggagttacaggtttgggagtg |
1686865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University