View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_24 (Length: 412)
Name: NF1739_high_24
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 68 - 151
Target Start/End: Original strand, 4776407 - 4776490
Alignment:
| Q |
68 |
ctttgagggaaaattgatctgcaagtgcctgtttaaattgatctagaaaactagaatcgttgccgcatagtaataaatcatcaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776407 |
ctttgagggaaaattgatctgcaagtgcctctttaaattgatctggaaaactagaatcgttgccgcatagtaataaatcatcaa |
4776490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 231 - 287
Target Start/End: Original strand, 446926 - 446982
Alignment:
| Q |
231 |
gagagagcaatgccgagaacaatcttcattgtttgaggtttgatgacagggctaaag |
287 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
446926 |
gagagagcaatgcagagaacaatcttgattgtttgaggtttgatgacagggctaaag |
446982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 21525 times since January 2019
Visitors: 1296