View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_46 (Length: 307)
Name: NF1739_high_46
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 11 - 120
Target Start/End: Original strand, 52191032 - 52191141
Alignment:
| Q |
11 |
cagagagaaagaaagtaaaaatagagtaccattggggtttgtcagtgagattaatcaaatggatgttgtgtgggatcttcttctcttccaaagttaagag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52191032 |
cagagagaaagaaagtaaaaatagagtaccattggggtttgtcagtgagattaatcaaatggatgttgtgtgggatcttcttctcttccaaagttaagag |
52191131 |
T |
 |
| Q |
111 |
aaccctctgg |
120 |
Q |
| |
|
|||||||||| |
|
|
| T |
52191132 |
aaccctctgg |
52191141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 211 - 291
Target Start/End: Original strand, 52191229 - 52191309
Alignment:
| Q |
211 |
gcgtacagtctccgagaatagttggagcaccaacagcagccttgacagcaacctcaagagccatttgcgatgaaatcaatg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52191229 |
gcgtacagtctccgagaatagttggagcaccaacagcagccttgacagcaacctcaagagccatttgcgatgaaatcaatg |
52191309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University