View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_55 (Length: 283)
Name: NF1739_high_55
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 52197758 - 52197554
Alignment:
| Q |
18 |
aaaatcaccggtaagccattgactatggtagtgaagttagcgtgaaggataaaaaacggtggtgaaattagcgcgaaggacaaaaaatggtctcccttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52197758 |
aaaatcaccggtaagccattgactatggtagtgaagttagtgtgaaggataaaaaacggtggtgaaattagcgcgaaggacaaaaaatggtctcccttat |
52197659 |
T |
 |
| Q |
118 |
cccccaatagaaaacacacactttgttagcgttttatgagcatcaattctttcttcgaccctaacgagccttacgaattcaactcacataaacaaattta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52197658 |
cccccaatagaaaacacacactttgttagcgttttatgagcatcaattctttcttcgaccctaacgagccttacgaattcaactcacataaacaaattta |
52197559 |
T |
 |
| Q |
218 |
aatcc |
222 |
Q |
| |
|
||||| |
|
|
| T |
52197558 |
aatcc |
52197554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 206 - 261
Target Start/End: Complemental strand, 52197553 - 52197498
Alignment:
| Q |
206 |
taaacaaatttaaatccaacctcttcaaagtgtaagcaggctatctaacacaacaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52197553 |
taaacaaatttaaatccaacctcttcaaagtgtaagcaggctatctaacacaacaa |
52197498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University