View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_57 (Length: 276)
Name: NF1739_high_57
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 68 - 261
Target Start/End: Original strand, 46740744 - 46740937
Alignment:
| Q |
68 |
tcctacccattgcatacctatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaaccgtcattctccattc |
167 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46740744 |
tcctacccattgcataactatagtttagtaactctatttggttacattctagtctagtctagtagcatgcactagtaaacaaaactgtcattctccattc |
46740843 |
T |
 |
| Q |
168 |
atttcatggtatacatttataatatccccgacaaatcatcatcctttagctttagtagcataatggaaatgatgtggactcttttagtggagag |
261 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46740844 |
atttcatgatatacatttataatatccccgacaaatcatcatcctttagctttagcagcataatggaaatgatgtggactcttttagtggagag |
46740937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 17 - 69
Target Start/End: Original strand, 46740612 - 46740664
Alignment:
| Q |
17 |
atgaagcagagatactcaaatatgtcggagatgtgaatgaaattcaatttctc |
69 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46740612 |
atgaagcagagatactcaaatatgttggagatgtgaatgaaattcaatttctc |
46740664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University