View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_59 (Length: 273)
Name: NF1739_high_59
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 262
Target Start/End: Original strand, 37054451 - 37054694
Alignment:
| Q |
19 |
gctgacacagttaatgctattgcagctgatcctaacttcactgcagctttagcagctgctattacttcaattattggggcggcgcagccaaacaataaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054451 |
gctgacacagttaatgctattgcagctgatcctaacttcactgcagctttagcagctgctattacttcaattattggggcggcgcagccaaacaataaca |
37054550 |
T |
 |
| Q |
119 |
acggtactagcaataatggtaacggtacaatagctaataacagtaatggcaatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054551 |
acggtactagcaataatggtaacggtacaatagctaataacagtaatggcaatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcc |
37054650 |
T |
 |
| Q |
219 |
caactcttcagtagagtagctagctcacaaagtgataacttcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054651 |
caactcttcagtagagtagctagctcacaaagtgataacttcat |
37054694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University