View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_82 (Length: 248)
Name: NF1739_high_82
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_82 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 29015013 - 29015247
Alignment:
| Q |
1 |
ccctgatggaacagtaaacaagttcaaggcaagactggttgccaaaggcttccaccaacagtttggagctgactactcggaaacttccccctcctgtcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29015013 |
ccctgatggaacagtaaacaagttcaaggcaagactggttgccaaaggcttccaccaacagtt-ggaactgactactcggaaacttccccctcctgtcat |
29015111 |
T |
|
| Q |
101 |
taaatctgtcactgtcagaaccatactcgctttggcacttactcaatcctggccccttcttcaactagatattaacaatgcgtttttgaatggacttctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29015112 |
taaatctgtcactgtcagaaccatactcgctttggcacttactcaatcctggccccttcttcaactagatattaacaacgcgtttttgaatggacttctc |
29015211 |
T |
|
| Q |
201 |
gaagaagaggtctatatggttcaacctccatgcttc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29015212 |
gaagaagaggtctatatggttcaacctccatgcttc |
29015247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12711 times since January 2019
Visitors: 1127