View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_92 (Length: 238)
Name: NF1739_high_92
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43615664 - 43615443
Alignment:
| Q |
1 |
ttattttaacactttaatcaatatcttaatgatactcgttagcattctccgaatactttttcatatacttgtaacatgtgttttttctgttaaatnnnnn |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43615664 |
ttattttaacactttaattaatatcttaatgatactcgttagcattctccgaataccttttcatgtacttgtaacatgtgttttttctgttaaataaaaa |
43615565 |
T |
 |
| Q |
101 |
nnnnnn-cttctgtagtgaaaaatatctgttggagtatatacttggtggggcctttacaaattgaagtccatgtctaacgtatttgtctcaaccctatag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43615564 |
aaaaaaacttctgtagtgaaaaatatctgttggagtatatacttggtggggcctttacaaattgaagtccatgtctaacgtatttgtctcaaccctatag |
43615465 |
T |
 |
| Q |
200 |
catagcatggtataggtcatcc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43615464 |
catagcatggtataggtcatcc |
43615443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University