View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_high_97 (Length: 234)
Name: NF1739_high_97
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_high_97 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 21061667 - 21061447
Alignment:
| Q |
1 |
aatgatctacgtgaatggtggcatgagttaacgcacacacctttctgcatcacacaaaacacgttttttaaatggtttggatggtgatcagatgataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21061667 |
aatgatctacgtgaatggtggcgtgagttaactcacacacctttctgcatcacacaaaacacgttttttaaatggtttggatggtgatcagataataaaa |
21061568 |
T |
|
| Q |
101 |
ctctctttcgaattttttcctctcaaannnnnnnctcatagtgttattaaaattgattcagagtatggttcatatagccaatgaaaaatagtaaagagag |
200 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21061567 |
ctctctttcggattttttcctctcaaatttttttctcatagtgttattaaaattgattcagagtatggttcatatagccaatgaaaaatagtaaagagag |
21061468 |
T |
|
| Q |
201 |
gctataatttaaggagatttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
21061467 |
gctataatttaaggagatttt |
21061447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 101
Target Start/End: Complemental strand, 123210 - 123152
Alignment:
| Q |
43 |
ttctgcatcacacaaaacacgttttttaaatggtttggatggtgatcagatgataaaac |
101 |
Q |
| |
|
||||||| |||| ||||||||||||||| | |||||||| |||| ||||||| |||||| |
|
|
| T |
123210 |
ttctgcaccacataaaacacgttttttagacggtttggacggtggtcagatggtaaaac |
123152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 27573815 - 27573899
Alignment:
| Q |
17 |
ggtggcatgagttaacgcacacacctttctgcatcacacaaaacacgttttttaaatggtttggatggtgatcagatgataaaac |
101 |
Q |
| |
|
|||||| ||||||||| || |||||||||||| |||| ||||||||| | ||||||||||||||| ||||||| |||||| |
|
|
| T |
27573815 |
ggtggcgtgagttaactcatgcacctttctgcaccacatttgtcacgtttttgagatggtttggatggtggtcagatggtaaaac |
27573899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University