View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_104 (Length: 231)
Name: NF1739_low_104
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_104 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 231
Target Start/End: Complemental strand, 23325902 - 23325684
Alignment:
| Q |
14 |
tcttaactataaaggttggaatatgccataaagaaaaatttattaattgctggtagttctatttcattatgattatttatagtgatatagtgacttgtga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23325902 |
tcttaactataaaggttggaatatgccataaagaaaaatttattaattgctggtagttctatttcattatgattatttatggtgatatagtgacttgtga |
23325803 |
T |
 |
| Q |
114 |
gctagaaggataaatggttgatgtttcaacc-nnnnnnnggataagtggttgacttggcattagacttttcaaagtcttgtggtgtacaagatatttctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23325802 |
gctagaaggataaatggttgatgtttcaaccaaaaaaaaggataagtggttgacttggcattagacttttcaaagtcttgtggtgtacaagatatttgtg |
23325703 |
T |
 |
| Q |
213 |
gacctagattccttaaagt |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23325702 |
gacctagattccttaaagt |
23325684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University