View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_109 (Length: 226)
Name: NF1739_low_109
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 210
Target Start/End: Complemental strand, 20818470 - 20818277
Alignment:
| Q |
19 |
cagaatctagtttgtgaatcagacatatagaataaacatcaaaatatatcccaccaaacacataatcgtatattgacaaagtatgaatttaaccttgatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
20818470 |
cagaatctagtttgtgaatcagacatatagaataaacatcaaaatatatctcaccaaacacataatcttatatagacaaagtatgaatttaaccttgatg |
20818371 |
T |
 |
| Q |
119 |
g--nnnnnnnnnnaccgtgaatgcatcaaagtcggctttcaagagttggattgatccacgggtatgttcaagctttgattctgatacagaaaag |
210 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20818370 |
gtttattttttttaccgtgaatgcaacaaagtcggctttcaagagttagattgatccacgggtatgttcaagctttgattctgatacagaaaag |
20818277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University