View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_13 (Length: 511)
Name: NF1739_low_13
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 18 - 499
Target Start/End: Complemental strand, 3361921 - 3361442
Alignment:
| Q |
18 |
cttattttacctcatctttggttattaattatctatatcagttttggtgttatacttatatgataaatgagtttatatctttttgcatgtactttgctgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361921 |
cttattttacctcatctttggttattaattatctatatcagttttggtgttatacttatatgataaatgagtttatatctttttgcatgtactttgctgg |
3361822 |
T |
|
| Q |
118 |
tgttagtttcctatgatggtaactactctgagagtcttgagtgccattatgattactttcactgtggatatggtatttattcttatactttctctccctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361821 |
tgttagtttcctatgatggtaactactctgag--tcttgagtgccactatgattactttcactgtggatatggtatttattcttatactttctctccctc |
3361724 |
T |
|
| Q |
218 |
tattttgtttggccctttttaggtgtctctatgttggtacttcgtatttctctgtttgttagttgagattttggtatccgaaccataggactgactaatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3361723 |
tattttgtttggccctttttaggtgtctctatgttggtacttggtatttttttgtttgttagttgagatttcggtatccgaaccataggactgactaatt |
3361624 |
T |
|
| Q |
318 |
cgaggagataaatcccaccgtgtatgttgataatttactgtagctttctgttgagttttgcagatgagattgaagaacatgccttgaatgtggaatcatg |
417 |
Q |
| |
|
|||||||| |||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361623 |
cgaggagacaaattcaaccgtctatgttgataatttactgtagctttctgttgagttttgcagatgagattgaagaacatgccttgaatgtggaatcatg |
3361524 |
T |
|
| Q |
418 |
tgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttgagaat |
499 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361523 |
tgttcaagttttgagaattttgaacaccaaggcagatgttgaaattgagaaactcgaaaatgatctcttgtgccttgagaat |
3361442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University