View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_37 (Length: 364)
Name: NF1739_low_37
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 186 - 352
Target Start/End: Original strand, 20184880 - 20185046
Alignment:
| Q |
186 |
aacatagccactctcacacaattacccctaaaacgttatgttttttcaagacatatnnnnnnnttatgaacatgaaagtaaagagaacaatcaaaatcaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20184880 |
aacatagccactctcacacaattacccctaaaaagttatgttttttcaagacatataaaaaaattatgaacatgaaagtaaagagaacaatcaaaatcaa |
20184979 |
T |
 |
| Q |
286 |
tgataatgtagaggtggggaataacagggacttttcaatcacttattagtgatgtaggagttgatga |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20184980 |
tgataatgtagaggtggggaataacagggacttttcaatcacttattagtgatgtaggagtttatga |
20185046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 10 - 138
Target Start/End: Original strand, 20184700 - 20184831
Alignment:
| Q |
10 |
aagaaaatagaggatgaggagataaattccttaattctatcatgctcaaggtaagatatcgtgcgtcaaaaa---tactgtgtataatgaagacattttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
20184700 |
aagaaaatagaggatgaggagataaattccttaattctatcatgctcaagataagatatcgtgcgtcagaaatactactgtgtataatgaagacattttt |
20184799 |
T |
 |
| Q |
107 |
ataattgtcatgcaaatattactactaagttg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20184800 |
ataattgtcatgcaaatattactactaagttg |
20184831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University