View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_43 (Length: 325)
Name: NF1739_low_43
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 11 - 309
Target Start/End: Complemental strand, 38900063 - 38899765
Alignment:
| Q |
11 |
catagggatacagttagtgaaaataacttgtgtttgattgattgtgtgtctaatatactttgtaaatagtaggtatttacatagccttgctcgactattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38900063 |
catagggatacagttagtgaaaataacttgtgtttgattgattgtgtgtctaatatactttgcaaatagtttgtatttacatagccttgctcgactattt |
38899964 |
T |
 |
| Q |
111 |
ttgtgtgtagtgtgttgattttccctcattgaggggattcatggcatcccacattcaatctcagcttcccacttcacgacacggtccattgatagagttc |
210 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38899963 |
ttgcgtgtagtgtgttgattttccctcattgaggggattcatggcatcccacattcaatctcagcttcccacttcacgacatggtccattgatagagttc |
38899864 |
T |
 |
| Q |
211 |
atagttgacaaactttccttaagatgtgcttctttactcatcgctcttaacggttttggtccctaaaaatactaaggaaaaatattgcaaagactaaaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||| ||||| |
|
|
| T |
38899863 |
atagttgacaaactttccttaagatgtgcctctttactcatcgctcttaacagttttggtccctaaaattactaagaaaaaatattgcaaagattaaaa |
38899765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University