View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_59 (Length: 277)
Name: NF1739_low_59
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1739_low_59 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 15 - 269
Target Start/End: Original strand, 3608949 - 3609203
Alignment:
Q |
15 |
acaaattacagtgacaaacgtcacctgcaatggtgaaaacactggactgagatattgtatggaaatggacaagatattgtggctgtgtgatgcatacgtc |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
3608949 |
acaaattacagtgacaaacgtcacctgcaatggtgaaaacactggactgagatattgtatggaaatggacaagatattgtagctgtgtgatgcatacgtc |
3609048 |
T |
|
Q |
115 |
aattaggctttgatatcctgaaatgggattcactggactaagatatttggacccactcaaagaccctccttcatgcaaaagcaagagaataaattaaagt |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3609049 |
aattaggctttgatatcctgaaatgggattcactggactaagatatttggacccactgaaagaccctccttcatgcaaaagcaagagaataaattaaagt |
3609148 |
T |
|
Q |
215 |
taggcactttgctgacctacttcattcatcatctcatgtatgtatatatattctt |
269 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
3609149 |
taggcactttgctgacctacttcattcatcatctcatgtatgtatatatgttctt |
3609203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19389 times since January 2019
Visitors: 1201