View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_61 (Length: 275)
Name: NF1739_low_61
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_61 |
 | |
|
| [»] scaffold0024 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 96 - 259
Target Start/End: Complemental strand, 29398 - 29235
Alignment:
| Q |
96 |
taaaatcctatagtttcatcctattatacaaacagcatccagcgactcagtattgtcaaatagcagctaatatggaactatagcgtagtggacagtattg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29398 |
taaaatcctatagtttcatcctattatacaaacagcatccagcgactcagtattgtcaaattgcagctaatgtggaactctagcgtagtggacagtattg |
29299 |
T |
|
| Q |
196 |
aacaaatcaatattgctctgtcatacactacttagtacaaatgttttcaaatatcgactataac |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
29298 |
aacaaatcaatattgctctgtcatacactacttagtacaaatgttctcaaatatcaactataac |
29235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 24 - 101
Target Start/End: Complemental strand, 29505 - 29428
Alignment:
| Q |
24 |
tgagtgaacaacaacaaaaaacatacatccagtgtcgtgtcttctgtaacacatccttcacgccaatattaataaaat |
101 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29505 |
tgagtgaacaacaacaaaaaacatgcatgcagtgtcgtctcttctgtaacacatccttcacgccaatattaataaaat |
29428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University