View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1739_low_62 (Length: 273)

Name: NF1739_low_62
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1739_low_62
NF1739_low_62
[»] chr2 (1 HSPs)
chr2 (19-262)||(37054451-37054694)


Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 262
Target Start/End: Original strand, 37054451 - 37054694
Alignment:
19 gctgacacagttaatgctattgcagctgatcctaacttcactgcagctttagcagctgctattacttcaattattggggcggcgcagccaaacaataaca 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37054451 gctgacacagttaatgctattgcagctgatcctaacttcactgcagctttagcagctgctattacttcaattattggggcggcgcagccaaacaataaca 37054550  T
119 acggtactagcaataatggtaacggtacaatagctaataacagtaatggcaatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37054551 acggtactagcaataatggtaacggtacaatagctaataacagtaatggcaatgttacatcaagtaacaataccaatggaagccctaaaatcaacaatcc 37054650  T
219 caactcttcagtagagtagctagctcacaaagtgataacttcat 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
37054651 caactcttcagtagagtagctagctcacaaagtgataacttcat 37054694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University