View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_66 (Length: 266)
Name: NF1739_low_66
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_66 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 21502337 - 21502089
Alignment:
| Q |
1 |
agtggcgttgttctctctcatagattctctgtttctgtaaaactaacaatggcggcgctgcttggtcacattctgaagacccaaaagaattcctcgcttc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21502337 |
agtggctttgttctctctcatagattctctgtttctgtaaa-ctaacaatggcggcgctgcttggtcacattctgaagacccaaaagaattcctcgcttc |
21502239 |
T |
 |
| Q |
101 |
ttcgcaacatcacttcctcttcgttgcatcaaacacctttcattctcccacctttatctcaaggtatttcaaatatcaaatcataacgatgatgataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
21502238 |
ttcgcaacatcacttcctcttcgttgcatcaaacacctttcattctcccacctttatctcaaggtatttcaaatttcaaatcataacgatgttgataatc |
21502139 |
T |
 |
| Q |
201 |
attattgataagttttcccgaaaattgcagaattttctagggtatcaatg |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21502138 |
attattgaaaagttttcccgaaaattgcagaattttctagggtatcaatg |
21502089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University