View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_68 (Length: 264)
Name: NF1739_low_68
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 47042720 - 47042961
Alignment:
| Q |
1 |
aacaaaatttaattatgcagcatgaagctggccattttttaattgcttatctggttggaatacttcctaaaggatatacactttctagtttggatggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47042720 |
aacaaaatttaattatgcagcatgaagctggccattttttaattgcttatctggttggaatacttcctaaaggatatacactttctagtttggatggtat |
47042819 |
T |
|
| Q |
101 |
gatgaaggagggttctctcaatattcaagcaggcacagcctttgtggattttgagtttctcgaagaagttggttgctttatttgttccgtatatttaatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47042820 |
gatgaaggagggttctctcaatattcaagcaggcacagcctttgtggattttgagtttctcgaagaagttggttgctttatttgttccgtatatttaatg |
47042919 |
T |
|
| Q |
201 |
cactatttttactttcaaaggtactagaaagagagaaaaagt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47042920 |
cactatttttactttcaaaggtactagaaagagagaaaaagt |
47042961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3055 times since January 2019
Visitors: 5821