View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_75 (Length: 254)
Name: NF1739_low_75
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_75 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 12502387 - 12502585
Alignment:
| Q |
9 |
agcataggaacaaggtcagttctgtaggcgagcacagtcataatactttcaagtggcaatgtgttcaagataacatataacaacccacaaactgcaccaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502387 |
agcataggaacaaggtcagttctgtaggcaagcacagtcataatactttcaagtggcaatgtgttcaagataacatataacaacccacaaactgcaccaa |
12502486 |
T |
|
| Q |
109 |
cggctgcaacctccatatcatctggcccattggcagctgaaatatctctgaataatatatttgtctgcacatgtcnnnnnnntgacatttcaccatcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12502487 |
cggctgcaacctccatatcatctggcccattggcagctgaaatatctctgaataatatatttgtctgcacatgtcaaaaaaatgacatttcaccatcaa |
12502585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 9 - 183
Target Start/End: Original strand, 12479353 - 12479527
Alignment:
| Q |
9 |
agcataggaacaaggtcagttctgtaggcgagcacagtcataatactttcaagtggcaatgtgttcaagataacatataacaacccacaaactgcaccaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
12479353 |
agcataggaacaaggtcagttctgtaggcgagcacagtcataatcctttcaattggcaatgtgttcaagacaacatataaaaacccgcaaactgcaccaa |
12479452 |
T |
|
| Q |
109 |
cggctgcaacctccatatcatctggcccattggcagctgaaatatctctgaataatatatttgtctgcacatgtc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
12479453 |
cggctgcaacctccatatcatctggcccattggcagatgaaatatctctaaataatatatttgtctgcaaatgtc |
12479527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University