View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_81 (Length: 249)
Name: NF1739_low_81
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_81 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 94 - 249
Target Start/End: Original strand, 6841746 - 6841901
Alignment:
| Q |
94 |
cacttaatgttgtgtttctcactgatctagaaataggatgatcgaaacttatacaatggggttgttattcatacgaccaaaacattattgtctcaaccac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6841746 |
cacttaatgttgtgtttctcactgatctagaaataggatgatcgaaacttatacaatggggttgttattcatacgaccaaaacattattgtctcaaccac |
6841845 |
T |
 |
| Q |
194 |
cccaattaatggtaccgtagacattttgacagaatattcaaaaactttacgtggat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6841846 |
cccaattaatggtaccgtagacattttgacagaatattcaaaaacttaacgtggat |
6841901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 6835989 - 6836074
Alignment:
| Q |
16 |
actagaaaaaattccacataaaaaactattttttctttcggtannnnnnnnctcactctctcaacaagtacatacatacacttaat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6835989 |
actagaaaaaattccacataaaaaactattttttctttcggtattttttttctcactctctcaacaagtacatacatacacttaat |
6836074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University